Difference between revisions of "Single Nucleotide Polymorphism workshop, Ljubljana"
(Created page with '320px') |
|||
Line 1: | Line 1: | ||
[[File:SNP_workshop.jpg|320px]] | [[File:SNP_workshop.jpg|320px]] | ||
+ | |||
+ | |||
+ | Dodatni material | ||
+ | |||
+ | |||
+ | A. Postopek za izolacijo DNA iz sline | ||
+ | |||
+ | 1. Saliva collection | ||
+ | |||
+ | a. Prior to collection of saliva samples, the donor should rinse their mouth with a few millilitres of water for 10 seconds in order to remove any food particles that may be present. If food particles are present they may cause clogging of the column. | ||
+ | |||
+ | b. Ten minutes after rinsing collect saliva by spitting into a sterile collection tube or vial. The amount of saliva collected should be at least 100 µL but not more than 2 mL. | ||
+ | |||
+ | c. Transfer 250 µL of liquid saliva to a sterile microcentrifuge tube. | ||
+ | |||
+ | d. Add 250 µL Lysis Solution, and mix by vortexing. | ||
+ | |||
+ | e. Incubate the saliva mixture at 55°C for a minimum of 1 hour. Mix the mixture by inversion for a few seconds after the incubation. | ||
+ | |||
+ | f. Add 10 µL of Proteinase K. Mix by vortexing and incubate at 55°C for 20 minutes. | ||
+ | |||
+ | g. Add 250 µL of Binding Solution the saliva sample. Mix by vortexing. | ||
+ | |||
+ | h. Add 750 µL of 96 % Ethanol and mix by vortexing for a few seconds. | ||
+ | |||
+ | |||
+ | 2. Sample Binding to Column | ||
+ | |||
+ | a. Assemble a column with one of the provided collection tubes. | ||
+ | |||
+ | b. Apply up to 760 µL of the lysate from Step 1 to the column and centrifuge for 1 minute at | ||
+ | |||
+ | 8,000 x g (~8,000 RPM). | ||
+ | Note: Ensure the entire sample has passed through into the collection tube by inspecting the column. If the entire sample volume has not passed, spin for additional 1 minute. | ||
+ | |||
+ | c. Discard the flowthrough and reassemble the spin column with its collection tube. | ||
+ | |||
+ | d. Repeat Steps 2b and 2c to complete the binding of the lysate to the column. | ||
+ | |||
+ | |||
+ | 3. Column Wash | ||
+ | |||
+ | a. Apply 500 µL of Wash Solution I to the column and centrifuge for 1 minute at 8,000 x g (~8,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube. | ||
+ | |||
+ | Note: Ensure the entire wash solution has passed through into the collection tube by inspecting the column. If the entire wash volume has not passed, spin for an additional minute. | ||
+ | |||
+ | b. Apply 500 µL of Wash Solution II to the column and centrifuge for 1 minute at 14,000 x g (~14,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube. | ||
+ | |||
+ | c. Spin the column for 2 minutes at 14,000 x g (~14,000 RPM) in order to thoroughly dry the column. Discard the collection tube. | ||
+ | |||
+ | 4. DNA Elution | ||
+ | |||
+ | a. Place the column into a fresh 1.7 mL Elution tube provided with the kit. | ||
+ | |||
+ | b. Add 50 µL of Elution Buffer to the column. Incubate for 1 minute. | ||
+ | |||
+ | c. Centrifuge for 1 minutes at 14,000 x g (~14,000 RPM). | ||
+ | |||
+ | |||
+ | B. Določanje OXTR polimorfizma (šifra rs53576) na osnovi genomske DNA | ||
+ | |||
+ | Zaporedje začetnih oligonukleotidov, ki smo jih uporabili pri reakciji PCR: | ||
+ | |||
+ | OXTR_F GCCCACCATGCTCTCCACATC | ||
+ | OXTR_R GCTGGACTCAGGAGGAATAGGGAC | ||
+ | |||
+ | Shematski prikaz gena OXTR z označenim mestom, kjer se nahaja polimorfizem in prijemališči začetnih oligonukleotidov. Kakšne velikosti bo odsek DNA, ki ga bomo pomnožili z reakcijo PCR? | ||
+ | |||
+ | |||
+ | |||
+ | Več podatkov o OXTR SNP najdete na spletni strani: http://www.snpedia.com/index.php/Rs53576 |
Revision as of 12:00, 11 April 2013
Dodatni material
A. Postopek za izolacijo DNA iz sline
1. Saliva collection
a. Prior to collection of saliva samples, the donor should rinse their mouth with a few millilitres of water for 10 seconds in order to remove any food particles that may be present. If food particles are present they may cause clogging of the column.
b. Ten minutes after rinsing collect saliva by spitting into a sterile collection tube or vial. The amount of saliva collected should be at least 100 µL but not more than 2 mL.
c. Transfer 250 µL of liquid saliva to a sterile microcentrifuge tube.
d. Add 250 µL Lysis Solution, and mix by vortexing.
e. Incubate the saliva mixture at 55°C for a minimum of 1 hour. Mix the mixture by inversion for a few seconds after the incubation.
f. Add 10 µL of Proteinase K. Mix by vortexing and incubate at 55°C for 20 minutes.
g. Add 250 µL of Binding Solution the saliva sample. Mix by vortexing.
h. Add 750 µL of 96 % Ethanol and mix by vortexing for a few seconds.
2. Sample Binding to Column
a. Assemble a column with one of the provided collection tubes.
b. Apply up to 760 µL of the lysate from Step 1 to the column and centrifuge for 1 minute at
8,000 x g (~8,000 RPM). Note: Ensure the entire sample has passed through into the collection tube by inspecting the column. If the entire sample volume has not passed, spin for additional 1 minute.
c. Discard the flowthrough and reassemble the spin column with its collection tube.
d. Repeat Steps 2b and 2c to complete the binding of the lysate to the column.
3. Column Wash
a. Apply 500 µL of Wash Solution I to the column and centrifuge for 1 minute at 8,000 x g (~8,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube.
Note: Ensure the entire wash solution has passed through into the collection tube by inspecting the column. If the entire wash volume has not passed, spin for an additional minute.
b. Apply 500 µL of Wash Solution II to the column and centrifuge for 1 minute at 14,000 x g (~14,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube.
c. Spin the column for 2 minutes at 14,000 x g (~14,000 RPM) in order to thoroughly dry the column. Discard the collection tube.
4. DNA Elution
a. Place the column into a fresh 1.7 mL Elution tube provided with the kit.
b. Add 50 µL of Elution Buffer to the column. Incubate for 1 minute.
c. Centrifuge for 1 minutes at 14,000 x g (~14,000 RPM).
B. Določanje OXTR polimorfizma (šifra rs53576) na osnovi genomske DNA
Zaporedje začetnih oligonukleotidov, ki smo jih uporabili pri reakciji PCR:
OXTR_F GCCCACCATGCTCTCCACATC OXTR_R GCTGGACTCAGGAGGAATAGGGAC
Shematski prikaz gena OXTR z označenim mestom, kjer se nahaja polimorfizem in prijemališči začetnih oligonukleotidov. Kakšne velikosti bo odsek DNA, ki ga bomo pomnožili z reakcijo PCR?
Več podatkov o OXTR SNP najdete na spletni strani: http://www.snpedia.com/index.php/Rs53576