CGCB 00002

From Hackteria Wiki
Revision as of 16:48, 10 June 2021 by Dusjagr (talk | contribs) (Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_))
Jump to: navigation, search

With the Mind thGAP release of the first fully knitted and reviewed GOSPHAs to the CGCB - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!

Contents

GOSPHA_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze

Author(s)

Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)

Name of Gene of Study

Links to websites where the gene is described

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/7Q3zdk8z8nTCdNb

How do you usually express yourself

What Organism(s) is the Gene Found In?

Where in the Organism(s) is the Gene Expressed?

Gene Action

SciRefs

More on those SciRef Authors

Reflections about your initial art as research

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L

GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAAATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAATAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGCGGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATTGACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCGGCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGGAGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGAATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTCGGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTTCGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAGCCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGCAAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTATGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCATTAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATAATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCACCCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAGTCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCGTAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTGAGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACGTAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTTTCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTTGGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTTAAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAGTGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCTGTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAGGAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACACTGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTCGTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACTATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGTAGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGACTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGCAGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCTTGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAGCATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGCTGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGGACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTGGAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCACAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAAGTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACTAAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGCTTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTGAGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTCGTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCGCCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATGGCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATTCTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGTTTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT 

full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

Method(s) of Transgenesis

Inducible Promoter

Reporter Genes

Write draw or sketch what you think this gene will do to change human

Name of your Creative Germline Transgenic Human Genome Alternatives Construct

Name of Gene of Study

bioart critic

Bioart Ethicist Review

Creative writing

GCCPNANCSAEMRSHRPL

GENERIC CREATIVE COMMONS NON-ATTRIBUTION, NONCOMMERCIAL, SHARE-ALIKE INTELLECTUAL PROPERTY EXPLICIT MODEL RELEASE SUBMISSIVE HUMAN RESEARCH PARTICIPANT LICENSE ("GCCPNANCSAEMRSHRPL") This Generic Human Subject Submissive Model MediArt Patient and Research Participant Creative Commons, Intellectual Property, Explicit Model Release Agreement License (hereinafter "GCCPNANCSAEMRSHRPL" or "Agreement") is made this day, June 6 2021 or after, by and between me and my team {above} (hereinafter "Explicit Model SubmissiveHuman Research Participant", MediArtPatient, Model, Model T human, "I", 'me", "you" or "it", Volunteer Prisoner) and (hereinafter "The Licensor", "The Company", "thGAP", GOSPHA, BEAK, psyFert, Hackteria ZET and/or CGCB). BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HERE, IT ACCEPTS AND AGREES TO BE BOUND BY THE TERMS OF THIS LICENSE. GRANTS IT THE RIGHTS CONTAINED HERE IN CONSIDERATION OF ITS ACCEPTANCE OF SUCH TERMS AND CONDITIONS.

The full GCCPNANCSAEMRSHRPL with all terms and conditions is here: https://mega.hackteria.org/index.php/s/6n8kMcHAdsRdGft



Edited GCCPNANCSAEMRSHRPL

If you intend to edit your GCCPNANCSAEMRSHRPL go to: https://mega.hackteria.org/index.php/s/6n8kMcHAdsRdGft and print or digitally alter with the following grammar based cutup editing, unworking techniques: add text and initialize, cross out text and initialize or circle and move text and initialize. Sign final document Then either email the altered PDF to vastalschool@gmail.com or old fashioned snail mail the amended GCCPNANCSAEMRSHRPL to thGAP, HAckteria ZET, Bitwäscherei 3. Stock, Alte Zentralwäscherei, ZWZ (near Bhf Hardbrücke) Neue Hard 12, 8005 Zürich. You may also list your edits below if you are that kind of contract unworker... just list page roman numeral and words you want removed, added or moved from where to where.