Difference between revisions of "CGCB 00002"

From Hackteria Wiki
Jump to: navigation, search
(Method(s) of Transgenesis)
 
(12 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
With the [[Mind thGAP]] release of the first fully knitted and reviewed GOSPHAs to the [[CGCB]] - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!
 
With the [[Mind thGAP]] release of the first fully knitted and reviewed GOSPHAs to the [[CGCB]] - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!
 +
 +
<div class="toclimit-3">__TOC__</div>
  
 
== GOSPHA_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze ==
 
== GOSPHA_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze ==
Line 5: Line 7:
 
=== Author(s) ===
 
=== Author(s) ===
  
Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
+
* Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
 +
* Neuro Extension Omnipotence Factory Fun (NEO-FFUN)
  
 
=== Name of Gene of Study ===
 
=== Name of Gene of Study ===
 
+
Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutants
  
 
=== Links to websites where the gene is described ===
 
=== Links to websites where the gene is described ===
Line 18: Line 21:
  
 
=== How do you usually express yourself ===
 
=== How do you usually express yourself ===
 
+
Good Sex
 
 
  
 
=== What Organism(s) is the Gene Found In? ===
 
=== What Organism(s) is the Gene Found In? ===
 
+
Drosophila
 
 
  
 
=== Where in the Organism(s) is the Gene Expressed? ===
 
=== Where in the Organism(s) is the Gene Expressed? ===
 
+
Brain
 
 
  
 
=== Gene Action ===
 
=== Gene Action ===
 
+
Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes
 
 
  
 
=== SciRefs ===
 
=== SciRefs ===
Line 60: Line 59:
 
* HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
 
* HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
 
* aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection
 
* aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection
 +
 +
=== Safe Harbor(s) ===
 +
* HsROSA26;
 +
* subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.;
 +
* Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.
  
 
=== Inducible Promoter ===
 
=== Inducible Promoter ===
 
+
chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.
 
 
  
 
=== Reporter Genes ===
 
=== Reporter Genes ===
 
+
Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types
 
 
  
 
=== Write draw or sketch what you think this gene will do to change human ===
 
=== Write draw or sketch what you think this gene will do to change human ===
 
+
Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu C~heese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.
 
 
  
 
=== Name of your Creative Germline Transgenic Human Genome Alternatives Construct ===
 
=== Name of your Creative Germline Transgenic Human Genome Alternatives Construct ===
 
+
Stinky (SnK2) WetNap (Wnp3k)
 
 
  
 
=== Name of Gene of Study ===
 
=== Name of Gene of Study ===
 +
bchs
  
 
+
=== Bioart Critic ===
 
 
=== bioart critic ===
 
 
 
 
 
  
 
=== Bioart Ethicist Review ===
 
=== Bioart Ethicist Review ===

Latest revision as of 18:17, 10 June 2021

With the Mind thGAP release of the first fully knitted and reviewed GOSPHAs to the CGCB - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!

Contents

GOSPHA_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze

Author(s)

  • Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
  • Neuro Extension Omnipotence Factory Fun (NEO-FFUN)

Name of Gene of Study

Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutants

Links to websites where the gene is described

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/7Q3zdk8z8nTCdNb

How do you usually express yourself

Good Sex

What Organism(s) is the Gene Found In?

Drosophila

Where in the Organism(s) is the Gene Expressed?

Brain

Gene Action

Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes

SciRefs

More on those SciRef Authors

Reflections about your initial art as research

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L

GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAAATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAATAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGCGGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATTGACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCGGCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGGAGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGAATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTCGGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTTCGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAGCCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGCAAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTATGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCATTAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATAATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCACCCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAGTCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCGTAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTGAGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACGTAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTTTCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTTGGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTTAAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAGTGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCTGTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAGGAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACACTGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTCGTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACTATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGTAGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGACTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGCAGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCTTGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAGCATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGCTGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGGACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTGGAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCACAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAAGTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACTAAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGCTTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTGAGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTCGTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCGCCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATGGCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATTCTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGTTTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT 

full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

Method(s) of Transgenesis

  • recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.
  • biolistics
  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines
  • HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
  • aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor(s)

  • HsROSA26;
  • subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.;
  • Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoter

chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types

Write draw or sketch what you think this gene will do to change human

Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu C~heese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.

Name of your Creative Germline Transgenic Human Genome Alternatives Construct

Stinky (SnK2) WetNap (Wnp3k)

Name of Gene of Study

bchs

Bioart Critic

Bioart Ethicist Review

Creative writing

GCCPNANCSAEMRSHRPL

GENERIC CREATIVE COMMONS NON-ATTRIBUTION, NONCOMMERCIAL, SHARE-ALIKE INTELLECTUAL PROPERTY EXPLICIT MODEL RELEASE SUBMISSIVE HUMAN RESEARCH PARTICIPANT LICENSE ("GCCPNANCSAEMRSHRPL") This Generic Human Subject Submissive Model MediArt Patient and Research Participant Creative Commons, Intellectual Property, Explicit Model Release Agreement License (hereinafter "GCCPNANCSAEMRSHRPL" or "Agreement") is made this day, June 6 2021 or after, by and between me and my team {above} (hereinafter "Explicit Model SubmissiveHuman Research Participant", MediArtPatient, Model, Model T human, "I", 'me", "you" or "it", Volunteer Prisoner) and (hereinafter "The Licensor", "The Company", "thGAP", GOSPHA, BEAK, psyFert, Hackteria ZET and/or CGCB). BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HERE, IT ACCEPTS AND AGREES TO BE BOUND BY THE TERMS OF THIS LICENSE. GRANTS IT THE RIGHTS CONTAINED HERE IN CONSIDERATION OF ITS ACCEPTANCE OF SUCH TERMS AND CONDITIONS.

The full GCCPNANCSAEMRSHRPL with all terms and conditions is here: https://mega.hackteria.org/index.php/s/6n8kMcHAdsRdGft



Edited GCCPNANCSAEMRSHRPL

If you intend to edit your GCCPNANCSAEMRSHRPL go to: https://mega.hackteria.org/index.php/s/6n8kMcHAdsRdGft and print or digitally alter with the following grammar based cutup editing, unworking techniques: add text and initialize, cross out text and initialize or circle and move text and initialize. Sign final document Then either email the altered PDF to vastalschool@gmail.com or old fashioned snail mail the amended GCCPNANCSAEMRSHRPL to thGAP, HAckteria ZET, Bitwäscherei 3. Stock, Alte Zentralwäscherei, ZWZ (near Bhf Hardbrücke) Neue Hard 12, 8005 Zürich. You may also list your edits below if you are that kind of contract unworker... just list page roman numeral and words you want removed, added or moved from where to where.