Difference between revisions of "CGCB"

From Hackteria Wiki
Jump to: navigation, search
(Method(s) of Transgenesis)
 
(19 intermediate revisions by 2 users not shown)
Line 2: Line 2:
  
 
<div class="toclimit-2">__TOC__</div>
 
<div class="toclimit-2">__TOC__</div>
 +
 +
{{:CGCBopen}}
 +
 +
{{:Bchs}}
 +
 +
{{:D.nft}}
 +
 +
{{:SuRaS}}
 +
 +
{{:Engoz}}
 +
 +
{{:Spike.loc.x1}}
 +
  
 
== Short description of generic GOSPHA ==
 
== Short description of generic GOSPHA ==
Line 107: Line 120:
  
 
== [[CGCB_00003]]:  ==
 
== [[CGCB_00003]]:  ==
 +
to be knitted
 +
 +
=== Author(s) ===
 +
 +
 +
 +
=== Gene Action ===
 +
 +
 +
=== Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)===
 +
 +
=== Folder name of your [https://mega.hackteria.org/index.php/s/tWbmPQHAxkPWftG Data Dump for files on the CGCB] ===
 +
 +
=== Method(s) of Transgenesis ===
 +
*
 +
 +
=== Safe Harbor ===
 +
 +
 +
=== Inducible Promoter ===
 +
 +
=== Reporter Genes ===
 +
 +
=== Write draw or sketch what you think this gene will do to change human ===
 +
 +
=== Bioart Critic ===
 +
 +
 +
=== Bioart Ethicist Review ===
 +
 +
 +
== [[CGCB_00004]]:  ==
 
to be knitted
 
to be knitted
  

Latest revision as of 18:25, 1 October 2021

With the Mind thGAP release of the first fully knitted and reviewed GOSPHAs to the CGCB - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!

Contents

Welcome to the thGAP: transgenic human Genome Alternatives Project CGCB: Creative Germline Construct Bank for use with GOSHPA: Generic Open Source Plasmid for Human Arts

These are the first 5 genes that are ready for final review on our open soource database. Please look over our gene descriptions, sequences and related art and biology data sets. Then click on one or more of the review buttons and give us your creative analysis.

Instructables - Step One study the data up to now:

Bchs

D.nft

SuRaS

Engoz

Spike.loc.x1


Part 2:

write one or more reviews:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab


ADDITIONAL GENERAL INFO:

By contributing your writing below, you are becoming a part of an open source movement to collaborate on a public bioinformatic database for artistic human genome alteration.

  In thGAP Lab 1 we explored GenBank and found Genes of interest and then we did research into: anatomy, scientific imagery, lateral web image soothsaying, and the power of naming/neologism.  
  In GOSHPA Lab2 we found the FASTA sequence of genes of choice and chose: Methods of Trans Gene Infection, Promoters, Markers and ‘Safe’ Harbors to land the genes in the Human Genome. We also released the first draft of the Generic Open Source Plasmid for Human Arts (GOSHPA).
  In CGCB Lab 3 We try different writing styles to analyze lab participant gene choices.

The topics covered are: bioart science fiction, bioart ethics and bioart criticism. Each entry is a single review but you can try out scifi, ethics or art criticism multiple times on any of the following genes.

Your writing can be as few as 100 words or you can offer a longer or even include multimedia responses. The reviews are centered on reading how you think it is to be the human engineered with the genes of the CGCB. The data here is qualitative not quantitative. It is based on your subjective ideas. We encourage your creative freedom in response to this call.

Abbreviated synopsis and links to the genes currently in our database: Bchs bChs: Under expression disrupts brain cell pooping (autophagy) allowing for the buildup of waxy fat (ceramides) that leads to neurodegeneration like Parkinsons. Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu Cheese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses.

D.nft D.nft, XMT-CYB, MT-CYBo: Underexpression dirsrupts female fertility, causes debility and makes adverse effects on health. Mitochondrial Cytochrome B Stops inflation with free radicals. Over expression Is Anti artherosclerosis and effects migrants stuck in Chinese and Bangladeshi Xinjiang Uyghur camps with their origin mutant MT-CYBo X. If Severe Obesity, give Benzo Barbs and remain clinically silent, you homoplasmic carriers!

SuRaS super repair after sunburn (SuRaS) – from XPA, RAD52: What it does Important for skin... (loss of function gives more skin cancer), repairs DNA - excision repair to get rid of bulky lesions and thymine dimers through nucleotide excision repair (NER), a specialized type of DNA repair. Repairs UV radiation-inducedchemical carcinogen induced and chemotherapeutic drug damage to DNA. Mutations in this gene cause Xeroderma pigmentosum skin disorder featuring hypersensitivity to sunlight and increased risk for skin cancer. Super humans with super repair won't fix new mutations in genome, when they repair common DNA damage.

Engoz engoz (from Hook1), Engoz_ph1 Contig: This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete, punctuated subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis (when a cell brings in food or other materials to be internalized, the cell surrounds the other stuff with cell membrane, and then ‘swallows’ or sort of coats the food with breading made of membrane wall that buds off inside the cell to form a vesicle containing the ingested material.

Spike.loc.x1 Spike.loc.x1, LOC107439103, AranaMadre Extremo Klattu, MadreAranaXyellow: aggregate spider glue-Aggregate spider glue from three spider types. (A) Orb weavers coat their web’s sticky capture spiral with glue, (B) cobweb weavers cover the lower portion of their triplines with glue to create ’gumfoot’ threads, (C) the bolas spider creates a large droplet of glue specialized for capturing moths, and (D) A stretching glue droplet after contacting a probe that was subsequently withdrawn at a constant rate. ...the creature lives in cold, dark places is a clan and builds external battery charging stations for itself and others. she is a mapping artist and translates relationships between places into symbols. a moving map. it can tap into a location with its network for years and save any information about it as a code.

The review is of the following genes as well as the humans they might make:
   1. blue cheese (Bchs) Stinky (SnK2) WetNap (Wnp3k)
   2. D.nft, XMT-CYB, MT-CYBo
   3. engoz (from Hook1), Engoz_ph1 Contig
   4. Spike.loc.x1, LOC107439103, AranaMadre Extremo Klattu, MadreAranaXyellow
   5. super repair after sunburn (SuRaS) – from XPA, RAD52

Feel free to go into deep research mode and review the information on these genes uploaded so far but don't leave forms tab before submitting or you may lose your work.

There are also links for optional multimedia uploads.

If you make a folder in the CGCB BioInfo Multimedia Database cloud be sure to enter the name of the folder you create on the CGCB BioInfo Multimedia Database in your CGCB BioInfo Database Entry Form.


Bioart Ethics - CGCB BioInfo Database Entry Form https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database: https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database: https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database: https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn

bChs: blue cheese (bchs), Stinky (SnK2), WetNap (Wnp3k)

      Synopsis: Under expression disrupts brain cell pooping (autophagy) allowing for the buildup of waxy fat (ceramides) that leads to neurodegeneration like Parkinsons. Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu Cheese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.

Become a part of the CBCD bChs entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the bChs entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn

Click here to go Back to the CGCD gene List: CGCBopen


bChs GOSPHA Basic Information

Name of Creative Germline Transgenic Human Genome Alternatives Construct:

Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila Blue Cheese Mutant Gene

Team Names

Neuro Extension Omnipotence Factory Fun (NEO-FFUN), Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)

Name of Gene of Study blue cheese (bchs) Mutant gene

How do you usually express yourself Good Sex

What Organism(s) is the Gene Found In? Drosophila

Where in the Organism(s) is the Gene Expressed? Brain

What Does the Gene Do? This is called Gene Action. What is the Action or Effect of the Gene? Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes Back to the CGCD gene List: CGCBopen

More information on bChs from our public and open source art and science bioinformatics database: Blue cheese pharma rescue.jpeg Maggie-fly.jpeg Suicide brains.jpeg Swisscheesemutant.jpg

File:Blue cheese Mutations Define a Novel, Conserved Gene Involved in Progressive Neural Degeneration.pdf

File:Blue Cheese (Barneys Farm) cannabis strain info.pdf

File:Drosophila melanogaster chromosome 2L - Nucleotide - NCBI.pdf

File:Ceramides And Stress Autophagic Defects In Neurodegenerative Drosophila blue cheese (bchs) Mutants.pdf

File:blueCheeseMutant DNA Sequence.pdf

Anonymous Bioart Critique by Mainstreaming Memesplaining and Spleen Maiming Sunday, June 6, 2021 3:53 PM Although I encountered the piece “Stinky (SnK2) WetNap (Wnp3k), Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutant Human” in person, I wonder if the viewer wouldn’t be better served engaging this particular mutagenic monstrosity from a distance or even virtually. This piece of moist mixed-media engages a variety of senses, but it is your nose that initially establishes contact with this other being. It is hard to determine—even for an accomplished critic such as myself—whether or not the creator of this piece is or ever was aware of their positionally. While the very act of creating and disseminating a transgenic human requires at a level of privilege unthinkable to most humans currently inhabiting the planet, we are never directly introduced with the maker. When I asked the organism itself about its provenance or genealogy, it just replied with the cryptic response “Please don’t recuperate me, boomer.” I indicated that I was in fact “somewhere between Gen. X and a millennial”. And what does the social construction of generational cleavages mean to a transgenic human who has a generation of only itself? This raises the fascinating question of originality. Does this artwork exist as a one-off or is part of a series? Is it a triptych or might it be part of a series of 100 copies? Or perhaps it is merely an artist proof or even a prototype? I myself am not interested in the art market, but certainly some readers will inevitably want to inquire about cost, price and potential value of such an artwork. I hope I need not spell out how problematic this line of inquiry is. Perhaps purchase an NFT of the genetic code of the gene insert to sate your unquenchable desire for the consumption and ownership of living artworks. Back to the work. Two words. It stank.

Method(s) of Transgenesis:

recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.; biolistics; lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines; HAC, Human Artificial Chromosome also known as the MicroChromosome or #47; aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor Landing Pads to Insert/lnfect the Human Genome:

HsROSA26; subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.; Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoters:

chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes:

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types.

GOSPHA Sequence:

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAA ATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAA TAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGC GGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATT GACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCG GCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGG AGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGA ATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTC GGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTT CGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAG CCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGC AAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTA TGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCAT TAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATA ATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCAC CCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAG TCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCG TAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAAC AGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGG CGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCC GCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTG AGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGT CAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAG CGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAG GTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAG ACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACG TAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTT TCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTT GGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTT AAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAG TGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCT GTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAG GAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACAC TGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTC GTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACT ATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGT AGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGA CTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGC AGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCT TGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAG CATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGC TGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGG ACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTG GAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCA CAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAA GTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACT AAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGC TTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTG AGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTC GTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCG CCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATG GCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATT CTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGT TTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

D.nft also known as XMT-CYB, MT-CYBo

    Synopsis: Under expression of D.nft disrupts female fertility, causes general debility and makes adverse effects on health. Mitochondrial Cytochrome B Stops inflation with free radicals. Over expression may be Anti artherosclerosis and explain effects on migrants stuck in Chinese and Bangladeshi Xinjiang Uyghur camps with their origin mutant MT-CYBo X. If Severe Obesity, give Benzo Barbs and remain clinically silent, you homoplasmic carriers! Mecha-spank.

Become a part of the CBCD D.nft entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the D.nft entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/RABoDCFNsgxyiL3


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn

Click here to go Back to the CGCD gene List: CGCBopen

Study the below art and science multimedia database entries to inform your entry.

More information on D.nft from our public and open source art and science bioinformatics database: Study the art and science multimedia database entry below to inform your commentary.


D.nft GOSPHA Basic Information Name of Creative Germline Transgenic Human Genome Alternatives Construct: D.nft XMT-CYB, MT-CYBo

Team Names: Ionian Pharma, HioHubGitGutter

Name of Gene of Study: cytochrome b

How do you usually express yourself: Other

What Organism(s) is the Gene Found In? : conical sea squirt (Lat. Aplidium conicum), human

Where in the Organism(s) is the Gene Expressed? : Mitochondria

What Does the Gene Do? What is the Action or Effect of the Gene? Mutation can cause health issues in sheep and effects female reproduction of Ghungroo pig. Mutation in Cytochrome B gene generally causes debility and adverse effects on health of sheep. Mutations in cytochrome B gene effects female reproduction of Ghungroo pigs.

Scientist involved in cytochrome b research: Aruna Pal, West Bengal University of Animal and Fishery Sciences, 37, K.B. Sarani, Kolkata 37, India.

File:msp234.pdf

File:Mutation in Cytochrome B gene causes debility and adverse effects on health of sheep _ Elsevier Enhanced Reader.pdf

Method(s) of Transgenesis,:

recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.; microinjection; Photoporation (laser); aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor Landing Pads:

human SHS AAVS1; "Safe" Mongr X: address on the X chromosome in Base Pairs (bp) chrX: 79,674,328–79,674,347 Sequence AAAATGTCATAAGgCAGTTT 3 out of 8 on the 'safe' harbor scale, site ID 321 from Table 2. Location and scoring of canonical and newly identified potential human safe harbor sites, New Human Chromosomal Sites with ‘‘Safe Harbor’’ Potential for Targeted Transgene Insertion, Hum Gene Ther . 2019 Jul;30(7):814-828. doi: 10.1089/hum.2018.169. Epub 2019 Mar 28.

Inducible Promoters:

Light Shock, Optogenetically Refined Wavelengths TBA; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes:

Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness. ; Gene Ween, tunable expression levels; Brainbow-2: random expression of different XFP ratios and subsequently causing different cells to exhibit a variety of colorful hues.; tattletale (TTLTL) DNA that codes for reporter protein molecules; specific membrane somatostatin receptors (hSSTrs) + DMT

GOSPHA Sequence:

Homo sapiens mitochondrion, complete genome NCBI Reference Sequence: NC_012920.1 GenBank Graphics >NC_012920.1:14747-15887 Homo sapiens mitochondrion, complete genome ATGACCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCC CATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCAC AGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACT CGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCC TCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCAT TATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTC TGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAA TCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTT CATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGA ATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTC TCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATAC CCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATT CTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAA TCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACT CCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATT GGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAA ACAAAATACTCAAATGGGCCT

super repair after sunburn (SuRaS) – from XPA, RAD52

      What SuRaS does is Important for skin... (loss of function gives more skin cancer), repairs DNA - excision repair to get rid of bulky lesions and thymine dimers through nucleotide excision repair (NER), a specialized type of DNA repair. Repairs UV radiation-inducedchemical carcinogen induced and chemotherapeutic drug damage to DNA. Mutations in this gene cause Xeroderma pigmentosum skin disorder featuring hypersensitivity to sunlight and increased risk for skin cancer. Super humans with super repair won't fix new mutations in genome, when they repair common DNA damage.

Become a part of the CBCD SuRaS entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the SuRaS entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn


Click here to go Back to the CGCD gene List: CGCBopen

Study the below art and science multimedia database entries to inform your entry.

SuRaS GOSPHA Basic Information

Name of Creative Germline Transgenic Human Genome Alternatives Construct: super repair after sunburn (SuRaS)

Team Names octopus teacher, RA's SuperRepair

How do you usually express yourself Eco Art or Gardening

Name of Gene of Study XPA, predicted human RAD52

What Organism(s) is the Gene Found In? All Organisms Living (AOL)

Where in the Organism(s) is the Gene Expressed? especially important for skin... (loss of function gives more skin cancer!)

What Does the Gene Do? This is called Gene Action. What is the Action or Effect of the Gene? repairs DNA - excision repair to get rid of bulky lesions and thymine dimers. Super humans with super repair won't fix new mutations in genome, when they repair common DNA damage.

Links to websites where the gene is described: genbank and ncbiPubMed https://www.ncbi.nlm.nih.gov/gene/7507, https://pubmed.ncbi.nlm.nih.gov/32235701/

Here are links about all the different repair pathways in humans... https://www.wikipathways.org/index.php/Pathway:WP4946 https://pubchem.ncbi.nlm.nih.gov/pathway/Reactome:R-HSA-5696398

Back to the CGCD gene List: CGCBopen

More information on bChs from our public and open source art and science bioinformatics database:

WheregeneExpresses.png


BulkyLesions.jpgDontEatMeHidden.jpg

XPA This gene encodes a zinc finger protein plays a central role in nucleotide excision repair (NER), a specialized type of DNA repair. NER is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens and chemotherapeutic drugs. The encoded protein interacts with DNA and several NER proteins, acting as a scaffold to assemble the NER incision complex at sites of DNA damage. Mutations in this gene cause Xeroderma pigmentosum complementation group A (XP-A), an autosomal recessive skin disorder featuring hypersensitivity to sunlight and increased risk for skin cancer. [provided by RefSeq, Aug 2017] Expression Ubiquitous expression in thyroid (RPKM 6.2), fat (RPKM 4.7) and 25 other tissues.

File:XPA DNA super repair.pdf

More info in pigmentation, skin cancer and transgonad solutions - The redefined DNA-binding domain of human xeroderma pigmentosum complementation group A: production, crystallization and structure solution, https://pubmed.ncbi.nlm.nih.gov/30605127/

Method(s) of Transgenesis: lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines

Safe Harbor Landing Pads: Rando

Inducible Promoters: No inducible promoter this GOSPHA, thank you.

Reporter Genes: Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness.

GOSPHA Sequence:

>XM_017019769.1 PREDICTED: Homo sapiens RAD52 homolog, DNA repair protein (RAD52), transcript variant X1, mRNA GAGACACCTAGCCCCGCCCCCAGCCCCGCCGCGGGGCGCAGCGCGCCTCCCCGGGCTCCCGGCTCGGCTG CCTCCCTTTCCCTCAGCCTCCCGGGAGCGTGACGCGGCGGCCCGGGGGCCTCCGGGCGCCTTCCGGGGCA CGCGGGATCGACATGCACTTGGATCATTGCAGTTTCTGGGCCTGCTGTCATCTCCCCCTTCAGTACTTCC CACATATGACTACCAACTGTTAGACGATGTGCTGCTGCCAGACCAGCCTTTCATTTCTTGGACATCCGGC TATTTACCCAGGAAAAGTCATCCTTTGACTATTTTTCATGACCTTTCTCATCTGACTCGTGATCTGCCCA TCTTGTTACTCCCTAGCAGTGTGGTAAGAGGTCAACCAGAATCAAGATGTCTGGGACTGAGGAAGCAATT CTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTGCCAGTACA CAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCG CATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATG TTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCA AGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGG TTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACA GACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAAGACTACC TGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGA TCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAG CTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCC GAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCA GCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAG GCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCTGGAGAAAG ACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGAC TCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTA GCCTTGAACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAA AATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAG GAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAACTGAGGCTCAGGCCACATAATTGGACT CTGTCACAAAGGGACTTTGGAAAACTACTTTTTGGTCATGAAATTGTTCATCGCTGCTGGAGAATGAACG TCATTGCGATTTATCTTGCTTCATTCTGAACCTTATCAAGAGGATCTGACTGAGAGCCCACTGCAGTTAG AGCTGAGCACTTTTGAAAAGCTTGTCCATCACTCTAGTAGGGAGAGGCTCTGGACAGATGAATACCTTTT CTTCGGCTTGTGAGGCTTCCCACTATTTATTACTGAACTATTATGTTAATGAAGATGGACATTTTAGGAA TCACCAATGGCTCCTTGCCCTCAAGCAATATAGGCCAGACTTGGTCCTAAGCACCTGCCTCAGCAATTGT CTACATTCAGTTGTTTTGCATAACGTCTGCCTTCTTTCCTTTACGGTCCATGCCTTTAATGTTGCCCACA TTAAGCACTGTGGATCACGACAGGAAAAAGGTTGGAGCAGTGCTTTTCACTACTTTGTATCAATCCAGGC TACAATCTTCATTTAATATAAATAATTTATGGATTTATGACATTACAATCCTGCATTGTTTCAAGACTGA CATTTTTTCCTAAGGAAGGAAATAATCATCTAAGACCACGAAAAAAGGCTGTTTTTTGTTTTTTTTTTTT TTTTTTTTTTTGAGACGGGGTCTGGCTGTGTTGCCCTGACTGGAGTTCAGTGGTGCAAACACAGCTCTCT CCACAACCTCTTGGGCCCAAGTGATACTCCCACCTCTGCCTTACAAAATACAGGGATTACTGGTGTGAGC CACTGTGTCTGGCCAGAAAAGGCATTTTTGAGAAAGCAAATCGTATACCTTATTAACAAAATAGAATATA TATATATTGCTTATCTGAAATGCTTGAAACCAGAATTGTTTTGCATTTTTTGAATATTTGTATACACATA ATGAGACCTTGGGGATGGGACCCAAGTCTGAACGTGGAATTCACCTGTGTTTCGTGTATATGCCTCATAC ACATAATTTTGTGCATGAAACAGAGTTTTTGTATAAGAAGATACACTGCAGCTGAAGAGGGCTGGGTTTT TTTTTCTCTTAGGGTCGCTGCATAAACTGTTGTATGCCTGGTGCTTTGCGACTTGTCACACGAGGTCACG TGTGGAATTTTCCACTTCTGGCATCACGTCAGTGCTCAGAAATTTTCTGATCTCAGAGCATTTCAATTAG GGATGCTCAAACGCAACTGTTTCTACTTCCCCATTTCAGGTGTGAGATGTAACCCACCTTGACCATAAAT TGGCTTTTCATAGTGCTCAGATGTTTCATAATTCTTCCCCCAAAATAATGAAGTTTGCAGTTTAACAACT TTTTTTTTGAGAGGGGGGGTCTGGCTCTGTAGCGCAGGCTGGAGTGCAGCGGTGCCATCTTGACTCATTG CAGCCTCCGCCTGCCAGGATTCAAGCAATTCTCCTGCCTCAGGCTCCCGAGTAGCTGGGATTACAGACAC CCACCACGACGCCCGACTAATTTTTGTATTTTTAGTAGAGGAGACGGGGTTTCTCCATGTTGGCCAGGCT GGTCTCAAACTGACCTCAAGTGATCTGCCCACCTCGGCCTCCCAAAGTAAAAAGTACTAGAATTATAGGC ATGAGCCATTGCGCCCAGCCAATTTAATAATTTTTTTAGACGTATTATTTTGGGCTGGGCTGTGGCTAAT CTTGAAGCAGTGACTTCCTATTTTTTGGCTCAGACCCATTTGGGAAGCTGTGAACCTGAGATAAGGAAGT CTGAAAGTACTAGCCGGCAGCCGACCGTTTCTATTCCTTTCGAAGTTAAGGAGACAGCAAAGGAGCTCCC AGGAATTAGGGATCCAGTTATAAATTGCACTTAACTCAAAATAGTGCCAGTGAGAATGTGAAGGAATCTT CTGGAAATGAAACCCCACAGCTCAACAAAAGCAAGTTTGGTTTATTTGAATGGTTTCATTAAATAAGTCT ACAAAGGTAACAAACTGAAGCACAAAGCGCAATCTTACAAGAAGCGCAACACCCAGAGTTAGTGCAAAAT GTACAATTAACGGCTGCTGAGAAACCCCCAAAGTTTGAATTTTTATTTTTATTTTTAACAGTGTACATTG TTAAA

engoz (from Hook1), Engoz_ph1 Contig

      This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete, punctuated subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis (when a cell brings in food or other materials to be internalized, the cell surrounds the other stuff with cell membrane, and then ‘swallows’ or sort of coats the food with breading made of membrane wall that buds off inside the cell to form a vesicle containing the ingested material. Its like your skin plastic wrapping every bite with skin that surrounds but then breaks away and goes with the ball that you bit… like spit is its own saran wrap protection or how we swallow into another outside as your digestive tract is not inside but actually we are donut shaped outsides.
      engoz loss of function is linked with Adenomia or benign skin tags of glandular origin. producing large amounts of hormones in an unregulated, non-feedback-dependent manner. Can run ragged on your hormonal imbalance causing paraneoplastic syndromes (see movie The Brood). Can cause abnormal headshape in both live young and abnormal head shape in sperm. Microtubule retraction ... deforms heads and deforms sperm heads but microtubules also grab and retract chromosomes with mean, biting centromeres so this might eat strangely at the chromosomes during reproduction or cell division. Overexpression effect unknown... gland shield? Endocytosis Enhancer?

Become a part of the CBCD engoz entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the engoz entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn

Click here to go Back to the CGCD gene List: CGCBopen


More information on engoz from our public and open source art and science bioinformatics database:

engoz GOSPHA Basic Information

Name of Creative Germline Transgenic Human Genome Alternatives Construct: engoz (from Hook1), Engoz_ph1 Contig

Team Names: providere, iBlastoidz

Name of Gene of Study: Hook1

How do you usually express yourself: Eco Art or Gardening

What Organism(s) is the Gene Found In? : Mouse (Murinae)

Where in the Organism(s) is the Gene Expressed? : Water-Cell in parathyroid gland ; sperm headshape

What Does the Gene Do? What is the Action or Effect of the Gene? : This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. Defects linked with Adenomia or abnormal headshape.

Murida-murinae.gif Engoz visual.jpg NumérisationEngozpsd.jpg

On this Soundcloud link, Kaspar Konig plays accordion as qualitative data after considering enGoz in the human germline:

https://soundcloud.com/andi-wallwhore/hook1-accordian-kaspar-konig

Method(s) of Transgenesis:

recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus. Sonoporation (sound waves), Photoporation (laser), aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor Landing Pads:

CCR5, human SHS AAVS1

Inducible Promoters:

Secretogranin II driven tetracycline-controlled transactivator Inducible and Reversible Rev-erbα and Clock Gene Oscillation Expression of Circadian Rhythmic Misbehavior, Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.

Reporter Genes:

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening, sudden eruption of exoskeletal chiton, tattletale (TTLTL) DNA that codes for reporter protein molecules.

GOSPHA Sequence:

>chromosome:GRCm39:4:95854877:95914250:1 File:Mus_musculus_Hook1_full_sequence.pdf

TGGACACATCATTATTATTATTTTTTAACATAGAAACGAGCAGGTAGGGTACACAGATAC AGCCTATGCTTTTTGAACACTATTTAATTTTGCTATCTAAAAACGGCCTTCCCCTTTGCC CCATTTAAAATGAAATCAGCCACAACCTGTGATTCTGTGAGGGCTTCTTTGACTTAGGCA GCATGGAGGTCTGTTTTTTCCTTAGGAAACACGTTTCTTGGTCACGTGGTTCCTCTTGCT TTGGGGGTTTCAATTCCTGAGCACTGTGGTGGGGAATGAGAAGAGGCTGGAGGCTGAGAG TGGGTCTGTACTAGTGCTAACCAGGAGAAATGGAAGGTTGGCCTCTGAGCCCTCCACTAC CTTTGGCCACTCTAGCTCGCGCAGGCGCGCTCTCCTTCCTACCCCCAGCCCCGCCCTCAT TGCACCTGCCAGGTCATAAACCTCCGCCCACCCACACCCGCTTCGCCTGGCGGTCCGGGC TTACCCCTCCTTGATTGGCCAAGAGTCTCTGGAGCGCGTCCAATCAGCAGCCCTCCTGTG CGACCTATTCCCGCTCCTCCCGCCCTGCCGGCCTCGCTGGTGCCCAGCTTCTTTGTGACT GGTGCTCGCAGAGGTCACTCAGCGTGCGGTGTGCGATCGGCGGGCGGGGCCGGCTCAGGT GCCGGGACGCGGGACAGACGCGGTGGGCGAGGGGGCGGTCGCGCCGCGACGTCTGCGCCG TGAGGCTTCGCGCGTGAGTGGCGCGGGCGCCAGGCCTGGCCGCCGAGCTCCAGTGGCGGG CGCGGAGGTCGTTGACGCGGGCCCGGTCGGAGGCGCGTCCGTCGCTGTGAGCGCGGCGTC GAGGTTCTCGGACCATGGAGGACCCGCAGCCGCTGCCACAGTCCGAGCTGCCGCTGTGTG ACAGCCTCATCATCTGGGTGAGTGTAGTTCCACGCTTGCCAGCGAGGCCACCTGCGGGGC GAGCGGAGCACGGAGCCTCCGGCTGCCACGTACACCTCCTCCGCAACCCTTCCGTCCCAG CCTCTGAGAGCTCCGCCTCGCACAGGTGACCAGGAGGCGCTGGCAGCCTCGGTTCCCAGA TTGCTGTCCTTTTGGGCCCACACAGCACCCATGGCGGTGTAGACACAGCTGAGAGAGATG GCCAAATTACCTTTGATGTGGGAGCTCTTTTTCATTTTTTCCCCCTCTTCCTCCCCTTCC CATCTTAATACCTTTCTTTTTTTAAAGTAAAAAAGAATTGGCTTTTTTTGTTTACGCTTG ATCCATGTGCAGGATTTTTTTAGCGCAGATTGCCTCAGTCCTCATTTTTTCCCAGTATTC CGGTGAGCCAAATGGTTTCTAACCTGTTGGAATTTCCTAGATATGACAGAACTGCCGTCC AGGTGTGATTTCTAGGCCTTTATTGTGCTAGGATAGTGTTTGATGCCCTACAGTTGGGTG TTGATAGCGCTGATGGCTCAACTCAGTTGTATAATTGTGAAGAGAGTCTGATTGGAATGT AAGTAGACTGGATCAGGAGGATTACATCCTCCAAGAGATTGACTGGCCATCTTCTAATAC TAGCAAATCCAAAGGACAAATAGGGAAGATCTCTATGAGTGTTTGAAATTTGTAGTCACT TTTGCACTTTAGACTTTGATAACATGTTTTAAGTAGAATGTAGTTAGGATCTCAGGGTTA AAGCGTTTAGCTCACTGTAGACCTGCATGTTTATTTAAATTACTATTTAGGTTTAGATAT TGTATTTAAGATTGTTAGGAAAGAAGGCAGTATTACTTTAATGATCCCATTTGTTTAAAA ACAAATGTCTAATCATAGGGTGTATTCAGGTCTGCAATTTTGTGCTCTGATCATCTGACT GAGATGGTAAACTGGGTTCTTTATGATGTCACTGACTTCCCTATGAGGTCACATGGAGTT CAAGAGTTTCTTAAACTATACTGCAATATTTCCAAGTGCTATGACCATATCCTTTCTTAA AGCAGTATTTTGACTTCCTACTTTGTGCTGGCCTCACAGGAATTAGTTTAACTAGCAGAG TTGTGTATCATTACAATGAAAGGCAAAGTTCCCCAAGATCTAGAGAGAGAGAGAGAAAGA GAGAGAGAGAAACAGAGAGAGAGAGGGAGAGACACACAGAGAGAGAGAGAATGAACCAGA TAAGGATTCATAGACAATAGAGGGTGAGAGGGTGGTTGGTTAGCTCTTGCTAATTGGCTC CTGCAGTGATCTCCCAGGCTGTTGTACACTGGAGAAAATTGAATGGCTGAAAATCAGTTA TTGCTTCTAATCATGGCGGTAGATGCACTGTTCTCCCTGACACTGTCCAGCTTGGTGATG GGGAAGGACATGGTGGTTCTGATTCTTTTTAGGACGCTTCATTGATGCCCTGCTTGGCTC TTCTTGGAACCGAATTTTGACTTTCAGGCACAATACCACCTCCTCAGCTTTGGGTCTTCC TTTAAACTCTGTTCCTTCTAACTCTTTTAGAGCATTGTTCTGCCATTTATTTTCTTTTTG CTGTTGAATCTGTCTAACCCTGACCCCCAACTAAACAAGGGATCTCTGCATGTGCTCTTC TGATGGAGCTGTGTCCTCAACCTCCTTTTTACTTAAGTCAAGACACAGTCTAAGATTTCC AGAAATCTTAGCCTGAATTCAATATGGCTGGTAGACGTGTGAGACTTCTTACACCTCCCA AGCGGCTGGGAGTACATTCTTGTGACAGCAGGCACTGCTGTTTACAGCGTGATTCAATTA GCCATTTCCTTCATATGCTTTCATTTAACCTTTTACTATTTTAAAAATAACTAAGGCACC ACTCTAGTTATTCCATGCTGTAATGCTTCCTCTTTCCCAGTAAAGTTACAACCCCCACAC CTTTATACTTTTTCCTTTCACTGCTCAGCCCATTATATTTTAATTCCTTTACTTTTAAAA AAAAATAAATTAGTTTATCTATTTACATTCCAAATGTTGCCCCTCTTCTTGGTTCCTCCT CCCAGAGTTCTTCACCTCATCGTCCTTCCCTTTGTTTTACAGAGGGTGCTCATCCCCACC CCTTCACCTTTCCATACCCCCCTTTGCATCCCCCCCAACCTTTCCACCCCCCCCAATCCC CAGCAACTCTCACCTCACCCACTCTCAAGAATCCCTCTTCCCTGGGGTATCTACTCTTTA CAGTAAGTTTAGCACAGCCTCACCCACTGAGGCCATATAAGGCAGTCCTCTGTTACATAT GTGCTGAGGGCCATAGACCAACCCTTGTATGCTCTTTGGTTGGTGGCTTGGTCTCTAGGA GCTCCAGGGGACCAGGGTAGTTGATCCTGGTGGTCTTCCTGTGGGGTTGCCATCCCCTTC AGCTCCTTCAATTCTTCCCCTAACTCTTCCATAGGAATTTCCAACTTTAGTCCAATGGTT GGCTGTAAGTATCTGCATCTGTCTCAGTCAGCTGCTGGTGAAGCCTCTCAGATGACAGCC ATGCTAGGCTCCTGTCTGCAAGCAGAACATGGCATCACTAATAGTGTCAGGGTTTGGTGC CTACTCCTGGGATGAATCTCAAGTTGCTCCAGTCACTGGGTAGCCTTTCCTTGAAACTTT GTTTCACTTTTGTCTCTGTATTTCCTTTAGATAGGATCAAAACTTTTAAAGATGGGTACA TCGCCCCATCCAGTCTCTGGGGTCCCTGTCTATGTACTGGAGGTGGTCTCTTCCAGTTCC ATCTCCCCACTGTTGGGTATTTCAGCTGAGGTTATCCCTATAATCACTGGAGGCAGAGGG AAGAAGGAACCTGAGTGGGAGGAGGAAGGGGATTGAAGCATCCTCATTTGGGCCTTCCTT TTTCTTAAACTTCCTATGGTTTTTGAGTTGTATTATGGGTATTCTGTACTTTTTGACTAA TAATCCACTTATTACTGAGTACATACCATGCATGTCATTTTTGGTCTGAGTCATCTAGCT

Spike.loc.x1, LOC107439103, AranaMadre Extremo Klattu, MadreAranaXyellow

      Aggregate spider glue from three spider types. (A) Orb weavers coat their web’s sticky capture spiral with glue, (B) cobweb weavers cover the lower portion of their triplines with glue to create ’gumfoot’ threads, (C) the bolas spider creates a large droplet of glue specialized for capturing moths, and (D) A stretching glue droplet after contacting a probe that was subsequently withdrawn at a constant rate. 
      The creature is surrounded by a silver, nebulous cloak of armor. It stores oxygen and all the nutrients it needs. It creates force fields with a 3m radius. in these fields, which do not exist for longer than 22 minutes, it burns information with its network as a code on the skin of the objects, places that come into contact with the network ... it communicates with the eyes
      the creature lives in cold, dark places is a clan and builds external battery charging stations for itself and others. she is a mapping artist and translates relationships between places into symbols. a moving map. it can tap into a location with its network for years and save any information about it as a code.
      Spike.locs are breathtakingly beautiful and masters of concentration. Their motto is to win without first beating the masters of command and control. the creature is a spy. With her long, pointed nails she feeds plants with her blood so that baby spikelocs do not have to hatch herself.

Become a part of the CBCD Spike.loc entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the Spike.loc.x1 entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:


Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn


Click here to go Back to the CGCD gene List: CGCBopen


More information on Spike.loc.x1 from our public and open source art and science bioinformatics database:

Spike.loc.x1 GOSPHA Basic Information Name of Creative Germline Transgenic Human Genome Alternatives Construct: Spike.loc.x1, Spike Lock, Lox X Spider

Team Names: KK, MadreAranaXyellow, AranaMadre Extremo Klattu

Name of Gene of Study: LOC107439103

How do you usually express yourself: Making a Post on Social Media and then just Scrolling for Hours

What Organism(s) is the Gene Found In? : Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida; Araneae; Araneomorphae; Entelegynae; Araneoidea; Theridiidae; Parasteatoda, Common house spider-Parasteatoda tepidariorum

Where in the Organism(s) is the Gene Expressed? : aggregate spider glue

What Does the Gene Do? What is the Action or Effect of the Gene? : Aggregate spider glue from three spider types. (A) Orb weavers coat their web’s sticky capture spiral with glue, (B) cobweb weavers cover the lower portion of their triplines with glue to create ’gumfoot’ threads, (C) the bolas spider creates a large droplet of glue specialized for capturing moths, and (D) A stretching glue droplet after contacting a probe that was subsequently withdrawn at a constant rate.

Example Scientists and Institutions involved in Research on this gene: Sarah D. Stellwagen *Department of Biological Sciences, University of Maryland Baltimore County, Baltimore, MD 21250, Rebecca L. Renberg, General Technical Services, Adelphi, MD 20783 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6553539/

File:Recherche Spider glue.pdf

File:locX Spider sequence for Klattu.pdf

File:genetic modification of future humans.pdf

File:Spider Glue Spidroin Proteins.pdf

Photo 2021-06-07 14.07.22.jpegReceived 165144768991304.jpeg

Method(s) of Transgenesis: microinjection; biolistics; lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines; Sonoporation (sound waves); Photoporation (laser)

'Safe' Harbor Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

inducible promoter dPRL promoter, for use with humanMER20MER39, for Decidualization, aiding mammalian embryo implantation and maternal blood contact with the fetal system, placentation, pseudo-pregnancy, birth control and transgenic embryo implantation. Availability: Academic Institutions and Nonprofits only, https://www.addgene.org/35256/

Reporter Gene: vesicular monoamine transporter 2 (VMAT2), the 'GOD' gene

What do you think this gene will do to change human?

 Como es la creatura? Muy rapido, peude como saltar radial peude acer purtas para saltar dentro dissapear en other con webs tiny window to tiny window no hay aire el pelo tene oxygen between the hair microbubbulos de oxygena arriva sobre de la teirra total los atmospheras read minds space travel calling all occupants Klattu makes humans into space ships exoossos …

The Gene Sequence: Parasteatoda tepidariorum strain Goettingen unplaced genomic scaffold, Ptep_2.0 Scf5bK3_3, whole genome shotgun sequence NCBI Reference Sequence: NW_018383341.1 GenBank Graphics >NW_018383341.1:c2695495-2672598 Parasteatoda tepidariorum strain Goettingen unplaced genomic scaffold, Ptep_2.0 Scf5bK3_3, whole genome shotgun sequence ATTGGACAGTTTTGCGAGCACAACATGGGGTGGTTATCCCATGTAATTATCGCTATTTTTCTAATAGACA TTCATCCCACTAAGATTTATGCCCAGGAAGTAGGCATCGCACAAAATGATCCTTTGCTATCTCGAGAAAC TGGATCGAACTTTGCAAGTTCGTTTGTGAATTACTTAAAGTCATGCGGACAGTTTACCATAAAAGAAGCC GACCAGTTCAGGGAGGTATTGGATACTCTCACGGACGCATATGGAGATTTTGCTAACCTTCAGTTCCTGT CCCGGACGTCGATGATGGCGGCTGCTGCCGGATTTGCCGCTGCCATCTCTGAAAGGACTGCCAATGACGT GCACGCGGGTGACTTGATGCCCAAGTCTGGATGCGTCATAAATGCATTGAAGCATGCGTTTATAATGTCC ACAGGAGTATCTAACCCTTTCTTCATCTCGGAAGTAAGAAAACTGATCCAGATATTCTTCCTCACCGACG CCGCTCCCTTGGACGAGCTACCTGAACCTGAATACGTAGGTGATATTGGTGGAGAAGTGGCGGGAACGAA CCAAGGTCCAACCGGCGATTTAAGAGCAGCTGCTCCAGATGATTTAGCCGATGATGATGATTTAGGCGGA GGAGAGAAAGGAAAAAGAGGTGGACCCCGAGGAGATATGGAAGCAGGGATATTCTCCGCAATATTTGGCA GTGACGGAAGCAGCAGCAGCTACGAAACGACTGAATATGTAACAGGTGAATACCAAACAGGAGAATATGT AACAGGTGAATACCAAACAGGGGAATATGTAACTGGTGAATATGAGACTGGAGAATATGTAACTGGTGAA TATGAAACTGGAGAATACGTAACAGGTGAATATGCAACTGGAGAATATACAACAGGTGAATACGAAACAG GGGAATATGTAACAGGTGAATACGATACTGGGGAATATGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNAACAGGTGAATATGCAACTGGAGAATATACAACAGGTGAATACGAAA CAGGGGAATATGTAACAGGTGAATACTCGACAGGAGAATATGTCACCGGTGAATATACAAGTGGAGCAGC TGCTAGCAAGAAATGTGCTCCGAAAAAGAAAGGAATTATATCTGGTTTTATTACAGGAATTTTTGGAAGC AATGGAAGTGATGACTGTGAAGAAGAAACTGGTGAAGCTGTGTCAGCTGAATACCAATCTTACTATTATT ACTCATATATAACTGGTGAGTATTACTCAGGAGTTTTTGATTCTTATACATACAGAACAGATGAATATAT TACAGGAGAGTACTATACTGGCGAGTTTTCGTCAACTGATTACTACACGGGAGAAATAATTACTGCAGAA CAATACTCGGGTGGGTACGGATCTGGAGAATATTCGTCAGCTGAAATTCCTACGTTTGTTGTATTACCAG GGCCTAATGGTGAGCAAAGACCAGTACAGATTGTAATTGCTGGGCCAGGATCGACACCAGGTACTGTTAC TAACTCGAATGGATTGCTTGTGAAAATTGTTTTGCCCTCTGGAGGTGATGTTACGCCTGGCACGATTCCG GGATCTAATGGAAGAACAATCCAGATAGTACCAGCAGGACCAGGCGTTACGCCAGGAATTATCACTGGTA CTGATGGTTATATAATTAAAATTGTTATACCAAGTTTTCCCCACCCCAAACCATTCCCACATCCAAATAA ACCAGGACGTCGTGTCATTTTTGTCACTGGACCGGGGGGCCGTCGAATTCAAATAGTACCCGCTGGCCCA GGAAGAACACCAGGTACTGTTACTGATAACAATGGAAACATCATTCGAATAATACTGCCAGCTGGAGGAG GTATTACTCCTGGATCCGTTAATGGACCAGGTGGTAGAAAAATAGTAATTATTCCTGTAGGTCCCGGTAC GTCACCTGGTGTCATCACTGGCTCTGACGGTAAAATCGCCACTATCAAAATTCCGCCATTCCCTCGGGGA GGAAGGAGACCTCATCACAGTACTCCGAGTTATGTTGAAGGCCCCGGTCGCCAGCTCATTCAGATAGTTC CTGGAGGACCTGGTACTACTCCGGGTGCTATTACAGGGCCAAGTGGAAACATTGTGCGAATCATACTACC CGCAGGAGCTGATGTAACACCTGGTAACATTAAAGGTCCCAATAACAGACAAATATATATTCAACCAGCT GGAAAAGGTACTACACCAGGAGTAGTTACAGGATCTGATGGCCAAATAGCCACAATAATTATACCACGAT TTAAAATTAGACATCCCTTCCATGGAGGATTCACTCCAGTCCCAATCAATGGTAATCATGGACAAGTGAT ATTAATAGTACCTGGTGGTCCAGGCAGAACACCAGGCTTCGTGACAGCAAAAGATGGCAATATAGTCAAA ATTATTTTACCGGCTGGAGCAGATGTAACACCAGGATCTCTTCCAGGCCCAGGCGGTAGACCTATCCGTA TAGAACCTGTTAGGCCAGGCACTACTCCAGGAGCAGTAACAGGCTCTGATGGAAATATTATTAAGATATT AATTCCTCAATTCCCCATGCCAGGTCCATATATTGAAGGAAGTACTCCTTTAACGATAAAACTTCCTGGC GGAAGACCTATTGCAGTAATACCGGGAGGACCAGGTACAACACCAGGAGTGGTTACAGATCCAAATGGCC GCATAATTAGAATTATATTACCGGCTGGTGCTGATGTAACTCCAGGAAGTATTGAAGGACCATATGGACA AACAATTAAAATTCAACCAGAAAGTCCAGGATCTACTCCAGGTGCAGTTACAAACAGTGATGGTCACATT ATAACAATTATAATACCTCTGTTACCCATGCCTGGTCCATTTGGACCTGGTACAACACCCTCTTACGTCA AAGGTCCGAAAGGTGAGCTAATACAGATAGTTCCAGGAGGTCCCGGCACAACACCTGGAGTTCAAACCGG TCCTTATGGAAATATCATTCGAATAATACTGCCAGCTGGAGGAGATGTAACACCAGGAACTGTCAAAGGA CCAGGTGGAAGGACAATAAAAATTAGACCCGCTGGACCTGGTACAACACCTGGCGTACGAACTGACTCAG ATGGCTATATAATCGAGATAATTATCGAAATTTTCCCAGCCCCAGGTCCATTCGGAGGAAGTACTCCCGC TTTCCTGCGAATTCCAGGCAGAAGACCAATCCAAATAATACCTGGAGGCCCCGGAACAACTCCAGGTACA GTTACAGATCGAAAAGGTAATATCATTAAAATAATTCTTCCCGGAGGAGCTGACGTTACTCCTGGATCAA TTGAAGGTCCAGATGGGCAACCCATTCAGATAATACCTGTGAGACCAGGAACAACACCAGGAGTTATAAC AGATCCTAACACTCACAAAATAATCAAAATTATAATACCGCAATTCCCATATAAAAATCCGTTTGGACCA GGAACCACTCCTGTTCAGATTGCAGGTCCTAATGGACGGCCGATTCAAATCATTCCCGCTGGGGCTGGAA CAACACCTGGCACAGTAACGGATAGACATGGAAGGATAATTCAAATTATTATTCCAGCGGGATCTGATGT AACACCAGGTTCAGTCGATGGACCAGGAGGAAGACCGATAAAGATAGTTCCAGTCGGTCCAGGATCAACG


Short description of generic GOSPHA

GOSPHA GRAPHIC. NNGL.jpg

Needs some description @neoangel

NNGL GOSPHA DNA.jpg

CGCB_00001: SuRaS - super repair after sunburn

Author(s)

  • octopus teacher
  • RA's SuperRepair
  • octopus teacher team 2

Gene Action

Repairs DNA - excision repair to get rid of bulky lesions and thymine dimers Here is a link about all the different repair pathways in humans... https://www.wikipathways.org/index.php/Pathway:WP4946 https://pubchem.ncbi.nlm.nih.gov/pathway/Reactome:R-HSA-5696398

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

>XM_017019769.1 PREDICTED: Homo sapiens RAD52 homolog, DNA repair protein (RAD52), transcript variant X1, mRNA

https://www.ncbi.nlm.nih.gov/gene/5893

GAGACACCTAGCCCCGCCCCCAGCCCCGCCGCGGGGCGCAGCGCGCCTCCCCGGGCTCCCGGCTCGGCTGCCTCCCTTTCCCTCAGCCTCCCGGGAGCGTGACGCGGCGGCCCGGGGGCCTCCGGGCGCCTTCCGGGGCACGCGGGATCGACATGCACTTGGATCATTGCAGTTTCTGGGCCTGCTGTCATCTCCCCCTTCAGTACTTCCCACATATGACTACCAACTGTTAGACGATGTGCTGCTGCCAGACCAGCCTTTCATTTCTTGGACATCCGGCTATTTACCCAGGAAAAGTCATCCTTTGACTATTTTTCATGACCTTTCTCATCTGACTCGTGATCTGCCCATCTTGTTACTCCCTAGCAGTGTGGTAAGAGGTCAACCAGAATCAAGATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAACTGAGGCTCAGGCCACATAATTGGACTCTGTCACAAAGGGACTTTGGAAAACTACTTTTTGGTCATGAAATTGTTCATCGCTGCTGGAGAATGAACGTCATTGCGATTTATCTTGCTTCATTCTGAACCTTATCAAGAGGATCTGACTGAGAGCCCACTGCAGTTAGAGCTGAGCACTTTTGAAAAGCTTGTCCATCACTCTAGTAGGGAGAGGCTCTGGACAGATGAATACCTTTTCTTCGGCTTGTGAGGCTTCCCACTATTTATTACTGAACTATTATGTAATGAAGATGGACATTTTAGGAATCACCAATGGCTCCTTGCCCTCAAGCAATATAGGCCAGACTTGGTCCTAAGCACCTGCCTCAGCAATTGTCTACATTCAGTTGTTTTGCATAACGTCTGCCTTCTTTCCTTTACGGTCCATGCCTTTAATGTTGCCCACATTAAGCACTGTGGATCACGACAGGAAAAAGGTTGGAGCAGTGCTTTTCACTACTTTGTATCAATCCAGGCTACAATCTTCATTTAATATAAATAATTTATGGATTTATGACATTACAATCCTGCATTGTTTCAAGACTGACATTTTTTCCTAAGGAAGGAAATAATCATCTAAGACCACGAAAAAAGGCTGTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTGAGACGGGGTCTGGCTGTGTTGCCCTGACTGGAGTTCAGTGGTGCAAACACAGCTCTCTCCACAACCTCTTGGGCCCAAGTGATACTCCCACCTCTGCCTTACAAAATACAGGGATTACTGGTGTGAGCCACTGTGTCTGGCCAGAAAAGGCATTTTTGAGAAAGCAAATCGTATACCTTATTAACAAAATAGAATATATATATATTGCTTATCTGAAATGCTTGAAACCAGAATTGTTTTGCATTTTTTGAATATTTGTATACACATAATGAGACCTTGGGGATGGGACCCAAGTCTGAACGTGGAATTCACCTGTGTTTCGTGTATATGCCTCATACACATAATTTTGTGCATGAAACAGAGTTTTTGTATAAGAAGATACACTGCAGCTGAAGAGGGCTGGGTTTTTTTTTCTCTTAGGGTCGCTGCATAAACTGTTGTATGCCTGGTGCTTTGCGACTTGTCACACGAGGTCACGTGTGGAATTTTCCACTTCTGGCATCACGTCAGTGCTCAGAAATTTTCTGATCTCAGAGCATTTCAATTAGGGATGCTCAAACGCAACTGTTTCTACTTCCCCATTTCAGGTGTGAGATGTAACCCACCTTGACCATAAATTGGCTTTTCATAGTGCTCAGATGTTTCATAATTCTTCCCCCAAAATAATGAAGTTTGCAGTTTAACAACTTTTTTTTTGAGAGGGGGGGTCTGGCTCTGTAGCGCAGGCTGGAGTGCAGCGGTGCCATCTTGACTCATTGCAGCCTCCGCCTGCCAGGATTCAAGCAATTCTCCTGCCTCAGGCTCCCGAGTAGCTGGGATTACAGACACCCACCACGACGCCCGACTAATTTTTGTATTTTTAGTAGAGGAGACGGGGTTTCTCCATGTTGGCCAGGCTGGTCTCAAACTGACCTCAAGTGATCTGCCCACCTCGGCCTCCCAAAGTAAAAAGTACTAGAATTATAGGCATGAGCCATTGCGCCCAGCCAATTTAATAATTTTTTTAGACGTATTATTTTGGGCTGGGCTGTGGCTAATCTTGAAGCAGTGACTTCCTATTTTTTGGCTCAGACCCATTTGGGAAGCTGTGAACCTGAGATAAGGAAGTCTGAAAGTACTAGCCGGCAGCCGACCGTTTCTATTCCTTTCGAAGTTAAGGAGACAGCAAAGGAGCTCCCAGGAATTAGGGATCCAGTTATAAATTGCACTTAACTCAAAATAGTGCCAGTGAGAATGTGAAGGAATCTTCTGGAAATGAAACCCCACAGCTCAACAAAAGCAAGTTTGGTTTATTTGAATGGTTTCATTAAATAAGTCTACAAAGGTAACAAACTGAAGCACAAAGCGCAATCTTACAAGAAGCGCAACACCCAGAGTTAGTGCAAAATGTACAATTAACGGCTGCTGAGAAACCCCCAAAGTTTGAATTTTTATTTTTATTTTTAACAGTGTACATTGTTAAA

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/LZziaSLaiQ6D25t

Method(s) of Transgenesis

  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines

Safe Harbor(s)

Inducible Promoter

No inducible promoter this GOSPHA, thank you.

Reporter Genes

Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness.

Write draw or sketch what you think this gene will do to change human

super humans with super repair won't fix new mutations in genome, when they repair common DNA damage

Bioart Critic

Face it, the whole idea of super repair is actually full of issues! if repair can't occur with mistakes, for instance, we might lose immune system function (and who knows what else, as the immune system recombinase is also active in the BRAIN!!) in our putative 'superrepair' transgenic being!

Bioart Ethicist Review

poor little transgenic being... obviously orthogonal. chameleon and taxonomy issues are evident. what kind of story could it have to tell, if it can only do pure homologous recombination, no matter what? an archipelago of nonsense ready to be viewed... better not to see it at all…


CGCB_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze

Ready for review

Author(s)

  • Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
  • Neuro Extension Omnipotence Factory Fun (NEO-FFUN)

Gene Action

Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L

GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAAATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAATAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGCGGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATTGACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCGGCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGGAGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGAATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTCGGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTTCGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAGCCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGCAAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTATGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCATTAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATAATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCACCCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAGTCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCGTAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTGAGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACGTAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTTTCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTTGGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTTAAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAGTGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCTGTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAGGAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACACTGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTCGTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACTATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGTAGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGACTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGCAGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCTTGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAGCATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGCTGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGGACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTGGAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCACAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAAGTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACTAAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGCTTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTGAGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTCGTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCGCCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATGGCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATTCTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGTTTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT 

full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

https://mega.hackteria.org/index.php/s/bpwxjJqCzNCwcr6

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/7Q3zdk8z8nTCdNb

Method(s) of Transgenesis

  • recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.
  • biolistics
  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines
  • HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
  • aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor(s)

  • HsROSA26;
  • subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.;
  • Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoter

chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types

Write draw or sketch what you think this gene will do to change human

Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu C~heese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.

Bioart Critic

Bioart Ethicist Review

CGCB_00003:

to be knitted

Author(s)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Folder name of your Data Dump for files on the CGCB

Method(s) of Transgenesis

Safe Harbor

Inducible Promoter

Reporter Genes

Write draw or sketch what you think this gene will do to change human

Bioart Critic

Bioart Ethicist Review

CGCB_00004:

to be knitted

Author(s)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Folder name of your Data Dump for files on the CGCB

Method(s) of Transgenesis

Safe Harbor

Inducible Promoter

Reporter Genes

Write draw or sketch what you think this gene will do to change human

Bioart Critic

Bioart Ethicist Review