Difference between revisions of "Bchs"

From Hackteria Wiki
Jump to: navigation, search
(3 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
       Synopsis: Under expression disrupts brain cell pooping (autophagy) allowing for the buildup of waxy fat (ceramides) that leads to neurodegeneration like Parkinsons. Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu Cheese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.
 
       Synopsis: Under expression disrupts brain cell pooping (autophagy) allowing for the buildup of waxy fat (ceramides) that leads to neurodegeneration like Parkinsons. Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu Cheese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.
  
Please add to the bChs entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:
+
Become a part of the CBCD bChs entry by writing 100 or more words as:
 
 
I want to add to the CBCD bChs entry by becoming:
 
 
a bioart critic
 
a bioart critic
 
a bioart ethicist  
 
a bioart ethicist  
 
a bioart science fiction writer
 
a bioart science fiction writer
  
Study the below art and science multimedia database entries to inform your entry.
+
Study the below art and science multimedia database entry to inform your commentary.
 +
 
 +
Please add to the bChs entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:
 +
 
 +
Bioart Ethics - CGCB BioInfo Database Entry Form
 +
 
 +
https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K
 +
 
 +
Bioart Ethics - CGCB BioInfo Multimedia Database:
 +
 
 +
https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd
 +
 
 +
 
 +
Bioart Science Fiction - CGCB BioInfo Database Entry Form
 +
 
 +
https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw
 +
 
 +
Bioart Science Fiction - CGCB BioInfo Multimedia Database:
 +
 
 +
https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32
 +
 
 +
 
 +
Bioart Critic - CGCB BioInfo Database Entry Form
 +
 
 +
https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab
 +
 
 +
Bioart Critic - CGCB BioInfo Multimedia Database:
 +
 
 +
https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn
 +
 
 +
Click here to go Back to the CGCD gene List:
 +
[[CGCBopen]]
 +
 
  
bChs GOSPHA Basic Information
+
'''bChs GOSPHA Basic Information'''
  
 
Name of Creative Germline Transgenic Human Genome Alternatives Construct:
 
Name of Creative Germline Transgenic Human Genome Alternatives Construct:
  
Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila Blue Cheese Mutant Gene
+
'''Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila Blue Cheese Mutant Gene'''
  
 
Team Names
 
Team Names
  
Neuro Extension Omnipotence Factory Fun (NEO-FFUN), Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
+
'''Neuro Extension Omnipotence Factory Fun (NEO-FFUN), Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)'''
  
 
Name of Gene of Study
 
Name of Gene of Study
blue cheese (bchs) Mutant gene
+
'''blue cheese (bchs) Mutant gene'''
 
   
 
   
 
How do you usually express yourself
 
How do you usually express yourself
Good Sex
+
'''Good Sex'''
  
 
What Organism(s) is the Gene Found In?  
 
What Organism(s) is the Gene Found In?  
Drosophila
+
'''Drosophila'''
  
 
Where in the Organism(s) is the Gene Expressed?  
 
Where in the Organism(s) is the Gene Expressed?  
Brain
+
'''Brain'''
  
 
What Does the Gene Do? This is called Gene Action. What is the Action or Effect of the Gene?  
 
What Does the Gene Do? This is called Gene Action. What is the Action or Effect of the Gene?  
 
+
'''Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes
Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes
+
'''
 
 
 
Back to the CGCD gene List:
 
Back to the CGCD gene List:
 
[[CGCBopen]]
 
[[CGCBopen]]
Line 57: Line 86:
 
[[:File:blueCheeseMutant DNA Sequence.pdf]]
 
[[:File:blueCheeseMutant DNA Sequence.pdf]]
  
 
+
'''Anonymous Bioart Critique by Mainstreaming Memesplaining and Spleen Maiming
First Anonymous Bioart Critique by Mainstreaming Memesplaining and Spleen Maiming
+
Sunday, June 6, 2021 3:53 PM'''
Sunday, June 6, 2021 3:53 PM
 
 
Although I encountered the piece “Stinky (SnK2) WetNap (Wnp3k), Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutant Human” in person, I wonder if the viewer wouldn’t be better served engaging this particular mutagenic monstrosity from a distance or even virtually. This piece of moist mixed-media engages a variety of senses, but it is your nose that initially establishes contact with this other being. It is hard to determine—even for an accomplished critic such as myself—whether or not the creator of this piece is or ever was aware of their positionally. While the very act of creating and disseminating a transgenic human requires at a level of privilege unthinkable to most humans currently inhabiting the planet, we are never directly introduced with the maker. When I asked the organism itself about its provenance or genealogy, it just replied with the cryptic response “Please don’t recuperate me, boomer.” I indicated that I was in fact “somewhere between Gen. X and a millennial”. And what does the social construction of generational cleavages mean to a transgenic human who has a generation of only itself? This raises the fascinating question of originality. Does this artwork exist as a one-off or is part of a series? Is it a triptych or might it be part of a series of 100 copies? Or perhaps it is merely an artist proof or even a prototype? I myself am not interested in the art market, but certainly some readers will inevitably want to inquire about cost, price and potential value of such an artwork. I hope I need not spell out how problematic this line of inquiry is. Perhaps purchase an NFT of the genetic code of the gene insert to sate your unquenchable desire for the consumption and ownership of living artworks. Back to the work. Two words. It stank.
 
Although I encountered the piece “Stinky (SnK2) WetNap (Wnp3k), Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutant Human” in person, I wonder if the viewer wouldn’t be better served engaging this particular mutagenic monstrosity from a distance or even virtually. This piece of moist mixed-media engages a variety of senses, but it is your nose that initially establishes contact with this other being. It is hard to determine—even for an accomplished critic such as myself—whether or not the creator of this piece is or ever was aware of their positionally. While the very act of creating and disseminating a transgenic human requires at a level of privilege unthinkable to most humans currently inhabiting the planet, we are never directly introduced with the maker. When I asked the organism itself about its provenance or genealogy, it just replied with the cryptic response “Please don’t recuperate me, boomer.” I indicated that I was in fact “somewhere between Gen. X and a millennial”. And what does the social construction of generational cleavages mean to a transgenic human who has a generation of only itself? This raises the fascinating question of originality. Does this artwork exist as a one-off or is part of a series? Is it a triptych or might it be part of a series of 100 copies? Or perhaps it is merely an artist proof or even a prototype? I myself am not interested in the art market, but certainly some readers will inevitably want to inquire about cost, price and potential value of such an artwork. I hope I need not spell out how problematic this line of inquiry is. Perhaps purchase an NFT of the genetic code of the gene insert to sate your unquenchable desire for the consumption and ownership of living artworks. Back to the work. Two words. It stank.
  

Revision as of 12:25, 2 October 2021

bChs: blue cheese (bchs), Stinky (SnK2), WetNap (Wnp3k)

      Synopsis: Under expression disrupts brain cell pooping (autophagy) allowing for the buildup of waxy fat (ceramides) that leads to neurodegeneration like Parkinsons. Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu Cheese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.

Become a part of the CBCD bChs entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer

Study the below art and science multimedia database entry to inform your commentary.

Please add to the bChs entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:

Bioart Ethics - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K

Bioart Ethics - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd


Bioart Science Fiction - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw

Bioart Science Fiction - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32


Bioart Critic - CGCB BioInfo Database Entry Form

https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab

Bioart Critic - CGCB BioInfo Multimedia Database:

https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn

Click here to go Back to the CGCD gene List: CGCBopen


bChs GOSPHA Basic Information

Name of Creative Germline Transgenic Human Genome Alternatives Construct:

Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila Blue Cheese Mutant Gene

Team Names

Neuro Extension Omnipotence Factory Fun (NEO-FFUN), Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)

Name of Gene of Study blue cheese (bchs) Mutant gene

How do you usually express yourself Good Sex

What Organism(s) is the Gene Found In? Drosophila

Where in the Organism(s) is the Gene Expressed? Brain

What Does the Gene Do? This is called Gene Action. What is the Action or Effect of the Gene? Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes Back to the CGCD gene List: CGCBopen

More information on bChs from our public and open source art and science bioinformatics database: Blue cheese pharma rescue.jpeg Maggie-fly.jpeg Suicide brains.jpeg Swisscheesemutant.jpg

File:Blue cheese Mutations Define a Novel, Conserved Gene Involved in Progressive Neural Degeneration.pdf

File:Blue Cheese (Barneys Farm) cannabis strain info.pdf

File:Drosophila melanogaster chromosome 2L - Nucleotide - NCBI.pdf

File:Ceramides And Stress Autophagic Defects In Neurodegenerative Drosophila blue cheese (bchs) Mutants.pdf

File:blueCheeseMutant DNA Sequence.pdf

Anonymous Bioart Critique by Mainstreaming Memesplaining and Spleen Maiming Sunday, June 6, 2021 3:53 PM Although I encountered the piece “Stinky (SnK2) WetNap (Wnp3k), Flies Are Us: Reassessing Normative Autophagic Neuro Life Extension via Drosophila blue cheese (bchs) Mutant Human” in person, I wonder if the viewer wouldn’t be better served engaging this particular mutagenic monstrosity from a distance or even virtually. This piece of moist mixed-media engages a variety of senses, but it is your nose that initially establishes contact with this other being. It is hard to determine—even for an accomplished critic such as myself—whether or not the creator of this piece is or ever was aware of their positionally. While the very act of creating and disseminating a transgenic human requires at a level of privilege unthinkable to most humans currently inhabiting the planet, we are never directly introduced with the maker. When I asked the organism itself about its provenance or genealogy, it just replied with the cryptic response “Please don’t recuperate me, boomer.” I indicated that I was in fact “somewhere between Gen. X and a millennial”. And what does the social construction of generational cleavages mean to a transgenic human who has a generation of only itself? This raises the fascinating question of originality. Does this artwork exist as a one-off or is part of a series? Is it a triptych or might it be part of a series of 100 copies? Or perhaps it is merely an artist proof or even a prototype? I myself am not interested in the art market, but certainly some readers will inevitably want to inquire about cost, price and potential value of such an artwork. I hope I need not spell out how problematic this line of inquiry is. Perhaps purchase an NFT of the genetic code of the gene insert to sate your unquenchable desire for the consumption and ownership of living artworks. Back to the work. Two words. It stank.

Method(s) of Transgenesis:

recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.; biolistics; lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines; HAC, Human Artificial Chromosome also known as the MicroChromosome or #47; aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor Landing Pads to Insert/lnfect the Human Genome:

HsROSA26; subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.; Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoters:

chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes:

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types.

GOSPHA Sequence:

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAA ATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAA TAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGC GGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATT GACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCG GCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGG AGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGA ATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTC GGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTT CGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAG CCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGC AAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTA TGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCAT TAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATA ATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCAC CCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAG TCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCG TAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAAC AGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGG CGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCC GCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTG AGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGT CAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAG CGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAG GTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAG ACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACG TAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTT TCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTT GGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTT AAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAG TGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCT GTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAG GAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACAC TGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTC GTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACT ATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGT AGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGA CTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGC AGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCT TGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAG CATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGC TGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGG ACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTG GAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCA CAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAA GTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACT AAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGC TTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTG AGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTC GTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCG CCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATG GCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATT CTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGT TTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5